Nous sommes le Jeu 26 Avr 2018, 04:39


Un peu de neurobiologie

La robotique est un domaine qui évolue rapidement. C'est pourquoi cette rubrique propose de rassembler les terminologies, nouvelles ou anciennes, qui le composent. Vous pouvez soumettre des définitions ou en demander.
  • Auteur
  • Message
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Un peu de neurobiologie

Message non luLun 18 Mai 2009, 17:53

Hola a todo el mundo !

J'ouvre ce sujet pour y mettre des choses que j'ai apprise à propos du système nerveux, mais le vrai. Je ferai ça post par post.
Le but est de montrer comment fait la nature pour faire un cerveau mais aussi de s'emerveiller devant la force de l'évolution. Le nombre de fois que j'ai dit "putaing" devant un livre de bio est assez important.

Je ferai dans l'ordre :
- le systeme nerveux et le neurone
- les principes de l'évolution
- du gene à la proteine
- du gene à la morphologie
- du gene au cerveau
- les systemes adaptatifs biologiques
- le systeme immunitaire
- le système nerveux

Je ferai des posts courts.

source : cours de bio d'antan, cours de biochimie 1ere année de fac, Biologie de la conscience de Gerald M Edelman, traité de magie de Papus (toujours) et SURTOUT vos corrections et précisions !!!

Ca peut etre utile.
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Hors ligne
Avatar de l’utilisateur

Sabrina

Bricoleur débutant

  • Messages: 13
  • Inscription: Dim 10 Mai 2009, 18:33

Re: Un peu de neurobiologie

Message non luLun 18 Mai 2009, 21:55

Bonjour Thot, je trouve que c'est une excellente initiative, car de mon point de vue la neurobiologie est plus qu'utile dans un projet comme celui de l'association. J'essaierai de t'aider un peu pour cette rubrique avec les références que j'ai chez moi qui sont des livres de neurosciences récents.
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Re: Un peu de neurobiologie

Message non luLun 18 Mai 2009, 23:15

Le système nerveux

Hola Sabrina... oula, je dois assurer alors... Non je ne vais peut-être pas aller dans les détails mais montrer ce qui peut être intéressant de savoir pour notre projet.

Sinon, je pense que la plupart d'entre nous sait ce qu'est le neurone avec les fameux réseaux neuronaux utilisés avec parcimonie mais dans des secteurs desfois insoupçonnés (et oui les avions utilisent des réseaux neuronaux).

C'est la brique élémentaire du système nerveux. Voici de quoi fournir en infos :
http://fr.wikipedia.org/wiki/Neurone

Mais pour résumer, le système nerveux est un système de communication interne au corps (entre les cellules). Je dis "un" parce qu'il ne faut pas oublier d'autres moyens de communications. En effet, notre corps est baigné dans le sang et la lymphe, des agents chimiques peuvent s'y déplacer, on les appelle les hormones :
- l'insuline régule le taux de sucre sanguin
- l'adrénaline permet de tonifier les muscles de manière instantanée (peur)
- l'endorphine procure du plaisir
... il y en a tout plein.

Le système nerveux n'utilise pas des agents chimiques mais des neurones qui forment un réseau. Les neurones se dévelloppent, naissent, meurent, migrent, vivent.
Elles possèdent plusieurs entrées (dendrites) et une seule sortie (axone). Le neurone intègre toutes les entrées pour fournir une sortie vers d'autres neurones etc...
Le bout de l'axone en "contact" avec les autres neurones s'appelle une synapse.
Le synapse est un espace entre les deux neurones qui peut etre remplit par des substances chimiques : les neurotransmetteurs. Ceux ci sont libérés par l'axone et atterrissent sur la membrane opposée pour l'exciter (ou l'inhiber).

Que veut dire exciter une cellule? tout se passe sur la membrane. C'est une histoire d'équilibre... ionique complexe. ce qu'il faut retenir c'est que la nature du signal c'est la propagation d'une perturbation sur la membrane de la cellule qui se deplace de proche en proche... et qui ne peut faire marche arrière. Chaque petite perturbation s'appelle un potentiel d'action PA.

C'est l'histoire du petit PA, il arrive sur le dendrite d'un neurone, il se propage, se mélange avec les autres PA et il arrive sur l'autoroute qu'est l'axone. Une fois arrivé au bout, il ne peut sauter sur l'autre neurone !! Pour cela, il fait liberer des agents chimiques. Ces agents font aller se fixer en face, et cette fixation entraine un autre PA... et ainsi de suite le signal se perpétue.

Petite anecdote, le neurone ne consomme que du glucose pour s'alimenter.

a suivre...
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Re: Un peu de neurobiologie

Message non luMar 19 Mai 2009, 21:13

Le Darwinisme

Un neurone est plus petit qu'un transistor à 3 pattes et est pourtant infiniment plus complexe et riche !! Le gars qui a inventé le neurone doit donc être méchamment plus intelligent que John Bardeen, William Shockley et Walter Brattain tous trois réunis !!

Eh bien personne n'a inventé cette merveille ! elle est issue de l'évolution. Ce principe qui a révolutionné les mentalités a été découvert par Darwin (1809-1882).
Cela explique pourquoi les être vivants ont évolué pendant des milliers d'années avant de commencer à faire des robots.
Cela tourne autour de deux concepts :
- la mutation génétique
- la sélection naturelle

1) la mutation génétique
Notre être, notre forme, notre espèce sont des choses que l'on apprend pas, elles viennent de notre code génétique. C'est une sorte de livre d'instruction ou tout est écrit avant que l'on naisse par l'union des livres de nos parents avec des lettres en moins, ou des lettres rajoutées aléatoirement. Ainsi, à chaque naissance, un nouveau livre sort. On peut obtenir ainsi une infinité de livres... mais tous ne sont pas des best-sellers.

2) La sélection naturelle
En effet, les êtres ne pouvant s'adapter à leur environnement mourront mangés par les prédateurs, noyés, asphyxiés... Ils ne pourront pas survivre. Mais quelque uns survivront, et comme les autres meurent... ils restent les seuls.

Ce principe est révolutionnaire puisque l'espèce ne s'adapte pas à la nature en réflechissant à sa forme mais elle est sujette à une sélection parmis une population.

Les girafes n'ont pas allongé leur cou pour manger les feuilles des arbres, c'est juste que les herbivores à cou courts (coucou à tout le monde d'ailleurs :arrow: ) sont tous morts de faim.

Pour finir avec un exemple : la phalène du bouleau est un papillon qui a les ailes de la couleur du bouleau, ainsi, quand il se pose dessus, on ne le voit pas et il risque moins d'être chassé.
Lors de la révolution industrielle en Angleterre, la suie du charbon commence à emplir l'atmosphère, ce qui fait que les bouleaux noircissent. Du coup on voit les phalènes blanche comme le nez au milieu de la figure... par contre, la petite population de phalènes noires, persécutée depuis la nuit des temps se trouve plus à son aise. On assiste donc à une diminution des phalènes blanches pour une augmentation des phalènes noires. Logique mais d'un point de vue autre on peut dire que les phalènes ont changé la couleur de leurs ailes lors de la révolution industrielle... méchamment intelligentes ces phalènes !!!

Image

Pour comprendre un peu mieux ce qui se passe, je vais essayer d'expliquer plus précisément comment passer du gène au nez.

à suivre...
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Re: Un peu de neurobiologie

Message non luMer 20 Mai 2009, 21:16

Biochimie du gène au mini-ouvrier

Juste un petit aparté sur les briques constituant le vivant (je mets les bases pour après monter à comment la mémoire fonctionne)

Les êtres vivants ont trois principales briques :
- les glucides
- les lipides
- les proteines

Les glucides sont des collliers de sucres plus ou moins grands. Le pain, les pates, le sucres... La digestion découpe les perles du collier qui sont des molecules simples de glucose (les oses en général)

Les lipides sont des corps gras qui n'aiment pas l'eau et qui ont une teneur en énergie très forte. Le corps peut transformer l'energie du lipide en energie glucide.

Les proteines qui sont des colliers d'acides aminés. On peut le voir plutôt comme une tuyauterie avec des morceaux de coudes. Se sont les acteurs du corps.
Il existe plein d'acides aminés différents.
Il y a aussi le cholesterol, les vitamines... mais c'est pas utile ici de savoir ce que c'est.

Maintenant que l'on voit la méca, ou se trouve le code? C'est dans le noyau des cellules que se trouve l'ADN organisé en chromosomes. L'ADN c'est un long collier constitué de 4 perles : Adenine, Thymine, Cytosine, Guanine (ATCG). Ainsi, une bout d'ADN peut s'écrire :
ACGTAGTCGATGCGTAGCTGA
Qu'est ce que ça veut dire? ce n'est pas da vinci code. C'est en fait un code tout entier (à la manière de l'assembleur) qui est régit par ce tableau (remplacer U par T):

http://fr.wikipedia.org/wiki/Code_g%C3%A9n%C3%A9tique

il faut découper le code 3 lettres par 3 pour avoir des "codons" et chaque codon à sa correspondance avec un acide aminé.

Des petits organes (les ribosomes) vont lire le code génétique et assembler les acides aminés entre-eux. Ils vont souder les coudes, les tuyaux bout à bout et à la fin on a une grosse molécule qui a une forme spéciale comme :
Image
anticorps
Image
hemoglobine

Cette forme bizarre permet de faire les choses les plus folles se coller, assembler des molécules, faire bouger, transformer telle energie en autre chose, donner une couleur... des petits ouvriers.
On a donc tous ces petits ouvriers codés en nous comme un langage informatique.

Pourquoi donc on a le nez au milieu de la figure? il y a un petit ouvrier qui dit que c'est comme ça ?

A suivre
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Re: Un peu de neurobiologie

Message non luSam 23 Mai 2009, 20:57

Du gène à la forme

Après ces paragraphes explicatifs, j'arrive a un paragraphe des plus difficile et important. Comment une séquence faite de ATCG peut coder un individu tel que l'homme en 3D ? Et par conséquent... fabriquer un cerveau (chose qui nous intéresse)

On a tendance à dire qu'il y a un gène "nez en trompette", "bras poilu", "menton allongé". Si on pouvait modifier ces gènes, on pourrait fabriquer son môme comme on veut !!

Cette problématique est encore à l'état de recherche mais il y a une théorie qui est intéressante.

Le gène ne code pas la position de chaque cellule en x, y et z, mais le développement de l'organisme. C'est ici que l'embryologie est une science importante.

Comment fait-on un homme? Bon vous connaissez tous l'histoire avant la cellule-œuf (petits coquins ;) )
Ensuite, cette cellule-œuf se divise, du coup on en a 2, puis 4, puis 8, 16, 32, 64... on a un ensemble de cellule qui ressemble à une mûre.
Il faut voir plusieurs phénomènes :
- 1 la différenciation
Dans chaque cellule, il y a le même code génétique mais tous les gènes ne s'expriment pas, il y a sélection de certains, voire amplification, inhibition d'autres... C'est ce qui fait qu'un neurone n'a pas la même forme qu'une cellule musculaire.
- 2 migration et liaison
On a vu qu'un gène code une protéine, eh bien il y a des protéines qui s'occupent d'attacher sa cellule à une autre, ces cellules attachées vont former un tissus qui va se différencier de la même manière. Il y a aussi des protéines de transports qui vont tisser des rails sur lesquels les cellules vont migrer.
- 3 vie et mort des cellules
Si j'ai parlé de l'évolution dans un paragraphe précédent c'est que ce principe est prépondérant dans les sciences de la vie !! :shock: la sélection naturelle fait son bouleau dans les cellules. Une cellule intestinale pourra apparaitre toute seule dans le cerveau mais elle mourra !

Ainsi, la différentiation dépend de la place de la cellule dépendant elle-même de l'expression de ses gènes... dépendant de sa différenciation...

Les gènes ne codent pas une forme mais un processus itératif super complexe de génération de la forme qui peut être influencé par le monde extérieur.

D'où l'importance de la protection de l'embryon dans un ventre ou un œuf.

Voici un article concernant l'embryologie humaine :
http://fr.wikipedia.org/wiki/Embryogen%C3%A8se_humaine

On y voit notamment la division en deux du corps et on voit aussi que l'un des premiers tissus à se différencier est le système nerveux.
Malheureusement, j'ai pas tout compris sur la formation de l'embryon (et il y a de quoi :!: ) si des personnes on des scoops concernant le cerveau...

J'arrive à un palier si des gens ont des remarques, des corrections, des ajouts, des questions... come on ::-D:
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Hors ligne
Avatar de l’utilisateur

philopat

Membre asso caliban

  • Messages: 1720
  • Inscription: Mer 5 Nov 2008, 01:19
  • Localisation: Jonzac

Re: Un peu de neurobiologie

Message non luJeu 28 Mai 2009, 18:16

merci Thot!

il faut que je prenne un peu de temps pour ingurgiter tout ça, mais sache que je ferais. ;)
alors si tu aimes, continue s'il manque encore des précisions et autres compléments.

Phil
ce qui voit , se voit dans les yeux de ceux qui nous regardent...
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Re: Un peu de neurobiologie

Message non luSam 30 Mai 2009, 20:32

Les systèmes auto-adaptatifs

Hola,

J'avais stoppé pour bien ingurgiter un concept très porteur : les systèmes auto-adaptatifs.
Cela décrit tous les système qui s'adaptent à leur environnement.
On peut voir trois issues pour s'adapter à son environnement :
- Connaitre le système, le système se connait et il peut prendre des décisions par rapport à ce qu'il perçoit. C'est une vision volontaire du système.
- Le système a des contraintes vis à vis de son environnement, une solution est de modifier l'environnement pour qu'il s'adapte au système. c'est le volontarisme poussé à l'extrême.
- Innover, regarder, en tirer des conclusions. Le tout sur une population gigantesque. La notion de population est capitale :
Le premier homme veut tester que si il appuie sur la gachette d'un revolver chargé pointé sur sa tempe il va mourir. Il teste et puis beh... c'est la fin de l'humanité.

On sent un certain bénéfice dans la troisième option. Pourtant, quand on regarde de l'extérieur, on ne peut déterminer facilement si la première ou la troisième option est utilisée. Je passe aux exemples :

- le principe d'évolution décrit plus haut est l'exemple le plus fort. Une girafe ne décide pas d'allonger son cou pour bouffer les feuilles les plus hautes, c'est que sur des millions d'individus sur des millions d'années elles ont survécut.

- Le système immunitaire est un bijou de technologie.
Le problème est le suivant, on a système fermé et on veut tuer tous ce qui rentre à l'intérieur et qui pourrait nuire au fonctionnement du système. 2 options :
- une cellule "couteau suisse" reconnait tous les types de corps étrangers (virus, bactéries) et quand elle en rencontre un, elle commande directement la réponse immunitaire.
- Un million de cellules est présente dans le système et chaque cellule ne reconnait qu'un seul type de corps. Quand elle en rencontre un, elle se divise à une vitesse folle, ce qui a tendance à commander la réponse immunitaire.
Bien sûr c'est la deuxième solution qui est adoptée. Et ca rend un système de défense super efficace. L'homme a su le doper grace au vaccin qui consiste à faire un rappel en introduisant une molécule qui imite le corps étranger.

- la téléréalité est un système auto-adaptatif, des millions de personnes sont sondés, auditionné et sur ce million il y en a au moins 8 qui sont au dessus du lot, on les fait passer à la sélection naturelle.

- l'entreprise est un système volontariste, on définit le produit que l'on veut faire, on décide tout, les essais infructueux seront sanctionné et donc à éviter.

- mais l'ensemble des entreprises est un système auto-adaptatif vis à vis des besoins humains ou des besoins à créer.

- Enfin, nous y venons, le cerveau est un système auto adaptatif. Des millions d'alternatives sont proposées, une sera faite. On a une population qui est immense et quand cette population augmente, la richesse augmente. l'évolution a vu que l'augmentation de la capacité cranienne est le seul moyen d'évolution de l'homme ! il n'a pas besoin de griffes plus pointues, de poil plus épais, le simple fait de rendre l'homme plus intelligent lui permet de s'adapter à son environnement.

C'est un système auto-adaptatif qui a crée le système auto-adaptatif le plus complexe...
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Hors ligne
Avatar de l’utilisateur

philopat

Membre asso caliban

  • Messages: 1720
  • Inscription: Mer 5 Nov 2008, 01:19
  • Localisation: Jonzac

Re: Un peu de neurobiologie

Message non luVen 12 Juin 2009, 17:15

salut et merci Thot

ça m'a donné encore pas d'idées tout ça.. ::-D:
le coup des anticorps , j'adore. il faut de ce pas que je révise mes equations!
mais c'est marrant à quel point ça ressemble au principe de pondération utilisé dans Caliban! (la créature...)
"si le chemin est tres usité alors on le favorise ".

et puis le programme integré au systeme adaptatif, qui lui attribue des prédispositions de mise en correspondance avec son contexte est vraiment tres interessant!
je crois bien que c'était ça que je cherchais comme principe d'adaptation, pour une micro-structure adaptative.
un programme de prédisposition de transformation symbiotique
et b'en tu sais ce que c'est ça? et b'en c'est un systeme expert dont la base de faits c'est la forme de la structure elle meme, et les regles , son programme de prédisposition!... facile.. ;) ::):
ça sous-entend à un algorithme récursif...

-Phil-
ce qui voit , se voit dans les yeux de ceux qui nous regardent...
Hors ligne
Avatar de l’utilisateur

Cybernaute

Membre asso caliban

  • Messages: 763
  • Inscription: Jeu 23 Oct 2008, 10:10
  • Localisation: Blond

Re: Un peu de neurobiologie

Message non luMer 17 Juin 2009, 13:19

:bravo: Magnifique boulot !

Moi c'est les mini-ouvriers qui m'inspire... Une bien meilleure vision de mes tisseurs de matrices...

ça cogite ! ;)
« la pratique est la forme la plus avancée de la théorie »
« le mouvement importe autant que la forme »
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Re: Un peu de neurobiologie

Message non luMer 17 Juin 2009, 18:38

merci
la partie qui arrive est super interessante sur la structure biologique du cerveau mais j'ai encore besoin de l'assimiler parce que c'est quand même hard. j'en suis à la relecture d'un chapitre pour la 3eme fois. C'est à la fois hard et bluffant.
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Re: Un peu de neurobiologie

Message non luMer 29 Juil 2009, 22:39

Bon je me lance, cette partie est la plus importante, elle définit les "3 lois de la neurobiologie" selon une théorie qui est généralement admise : la TSGN (Théorie de la Selection des Groupes Neuronaux) Elle appuie le fait que le système nerveux est un système adaptif darwinnien et qu'il est très dynamique.

- La dynamique primaire : Les neurones vivent, meurent, bougent, s'agrandissent, se raccourcissent, bourgeonnent... Ca bouillonne dans la cocotte !! cela permet d'observer une population de neurones ou plûtot une population de groupes neuronaux. Ce n'est pas la disparition ou la création d'un neurone qui va changer le monde mais plûtot l'évolution de "petits" groupes qui est intéressante.
Cet aspect est purement anatomique et une population de groupes neuronaux dans une certaine région s'appelle un répertoire primaire.
L'évolution des répertoires primaire est dictée par la génétique. Attention, le câblage n'est pas codé dans l'ADN, mais le génétique applique des contraintes à un comportement naturel.

- La dynamique secondaire : Par des procédés chimique, certaines connexions entre neurones peuvent être renforcés ou affaiblis, c'est le comportement le plus connu du neurone mais appliqué ici à la communication entre les groupes neuronaux.
Plus une connexion est active, plus elle est renforcée.
On a donc au fur et à mesure la création d'un réseau se fait AVEC TOUTES LES CONNEXIONS QUI N'ONT PAS DISPARUES (du bon Darwinisme ::): )
L'ensemble des connexions entre les groupes neuronaux d'une zone s'appelle le répertoire secondaire.

Ces deux dynamiques sont liées :
-Un sur-bourgeonnement d'un neurone peut provoquer l'intensification d'une connexion
- Une connexion qui sera plus active se renforcera et provoquera un dynamisme dans un groupe neuronal.

Ces deux dynamiques font apparaitre donc des groupes reliés entre eux par des connexions que l'on peut appeler "cartes". Exemple : le système visuel du singe est relié à une trentaine de cartes qui recoivent les stimulis visuels. Ces cartes peuvent recevoir d'autres signaux sensoriels... mais aussi d'autres signaux d'autres cartes !!!

- la réentrée
les cartes sont liées entre elles par des connexions dites réentrantes.
Ainsi, une carte qui a recu un stimulus de l'oeil et une carte qui en a recu un autre au meme moment de l'odorat vont communiquer et selectionner les groupes qu'elles ont excité en meme temps.
Code: Tout sélectionner
Carte1 : je vois un verre rouge
Carte2 : ca sent les fruits rouges
Carte1 : OK on renforce cette association?
Carte2 : Ca marche! tshusss !

2 semaines plus tard

Carte1 : Salut carte2! je vois un verre rouge au loin !!
Carte2 : Ok ca va etre des fruits rouges je vais prevenir carte 3 la derniere fois que les fruits rouges sont apparus elle m'a contacté.

... bref, le phénomène de catégorisation et donc le passage du biologique à la conscience se fait par ces trois lois.

Voila, j'espère avoir été clair, je passerai au système de valeurs plus tard (bien/mal... on recommence!!!)
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Hors ligne
Avatar de l’utilisateur

philopat

Membre asso caliban

  • Messages: 1720
  • Inscription: Mer 5 Nov 2008, 01:19
  • Localisation: Jonzac

Re: Un peu de neurobiologie

Message non luJeu 30 Juil 2009, 21:38

bonjour ou bonsoir à toi , cher thot !

:bravo:
cet exposé est celui que je préfère !
il est difficile à suivre uniquement parce que ce que tu as déjà bien appréhendé, tu le dis comme le reste que nous autres savons aussi. alors des petites choses anodines pour toi passent inaperçues pour nous, alors que ça fait une très nette différence quand on les apperçoit clairement.
je t'avouerais donc que j'ai du le relire 3 fois. :heu:

je vais te souligner les petites importances dont je parle:
Thot a écrit:- La dynamique secondaire : Par des procédés chimique, certaines connexions entre neurones peuvent être renforcés ou affaiblis, c'est le comportement le plus connu du neurone mais appliqué ici à la communication entre les groupes neuronaux.

=> et oui !! je n'y avais jusqu'à aujourd'hui jamais pensé !
ça me parait évident maintenant.
il s'agit de la pondération des processus ! on connait déjà celle des liens, celle des petits calculs autrement dit, mais là, la différence est de taille . chaque processus à donc un code hierarchique de fonctionnement dans le systeme global au niveau de ses interfaces! il s'agit bien d'une attribution de la limite de son pouvoir , de sa priorité, de son influence .
que ce soit au niveau des ordres émmanents du processus ou bien de ses lignes d'entrées.
ça me parait etre un point tres important.

alors il faut que je revise vraiment mon image floue de mon IA inachevée avant qu'il ne soit trop tard... héhé.
(ça va dire aussi que je suis en train d'etre serieusement ifluencé par tout ce que je decouvre ces derniers temps. il faudrait que je termine mon descripteur de la pensée avant de ne plus savoir le faire. :red: )

merci ::-D:

tu devrais ajouter un dessin pour qu'on comprenne la hierarchie pas evidente de tout ça , tout de même. c'est que je m'y perd un peu , dans les groupes et les sous groupes , les zones et les cartes. :roll:

-Phil-
ce qui voit , se voit dans les yeux de ceux qui nous regardent...
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Re: Un peu de neurobiologie

Message non luJeu 30 Juil 2009, 22:56

Merci pour les encouragements mais pour cette partie, je suis conscient que c'est chaud, il suffit de voir le temps entre l'avant dernier et le dernier article... ::-D:
Je dois avouer que ce que je compte attaquer (hippocampe, hypophyse et accordéons en Pologne du Sud) j'ai encore rien pipé... mais ça vient petit à petit. Mais p*t*** c'est bien foutu cette machine !!!
Je ferai des schémas la prochaine fois :roll:

"Ce qui ce conçoit bien s'énonce clairement."
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Hors ligne
Avatar de l’utilisateur

Thot

Membre asso caliban

  • Messages: 1139
  • Inscription: Lun 23 Fév 2009, 23:53
  • Localisation: Toulouse con

Re: Un peu de neurobiologie

Message non luMar 8 Sep 2009, 22:50

Un système auto-adaptatif

J'ai trouvé un système auto-adaptatif assez marrant. En ce moment, dans les montagnes, ce sont les estives (on ramene les troupeaux qui ont bien mangé à la maison). Le troupeau de mouton est un système adaptatif :

En effet, il y a deux éléments :
- une population
- des mutations
- une selection naturelle

Ce qui est adaptatif ici, c'est le guidage du troupeau. Les mutations sont les envies des moutons pour brouter un truc au bord de la route, ils peuvent s'eparpiller bien vite. La selection naturelle, c'est le chien de berger qui mort les pattes des moutons qui osent s'en aller. Tout ce travail est assez bluffant à voir en vrai puisque le berger ne fait rien du tout.
Projet Marionnettes électriques
"Il n'y a rien de plus étrange pour l'homme que son image." RUR - Karel Capek
Suivante

Retourner vers Lexique

Qui est en ligne

Utilisateurs parcourant ce forum: Aucun utilisateur enregistré et 1 invité

cron